gene: KCNMA1

organismHomo sapiens
full namepotassium calcium-activated channel subfamily M alpha 1
summaryMaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

NM_002247.3(KCNMA1):c.1680C>A (p.Ala560=) AND not specified

NM_002247.3(KCNMA1):c.31_54delAGCAGCGGCGGCGGCGGCGGCGGC (p.Ser11_Gly18del) AND not provided

NM_002247.3(KCNMA1):c.1749+11G>A AND Generalized epilepsy and paroxysmal dyskinesia

NM_002247.3(KCNMA1):c.*423_*425delGTT AND Generalized epilepsy and paroxysmal dyskinesia

NM_001014797.2(KCNMA1):c.2104C>T (p.Leu702Phe) AND not provided

... 231 more

Partner site online screenshot taker on