GENETIC ENCYCLOPEDIA
ABOUT US    

   

gene: COL6A1

id1291
symbolCOL6A1
organismHomo sapiens
full namecollagen type VI alpha 1 chain
summaryThe collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]
variant-disease

NM_001848.2(COL6A1):c.1022G>A (p.Gly341Asp) AND Bethlem myopathy 1

NM_001848.2(COL6A1):c.1977C>G (p.Tyr659Ter) AND Ullrich congenital muscular dystrophy 1

NM_001848.2(COL6A1):c.-5C>G AND not specified

NM_001848.2(COL6A1):c.1002+43_1002+81delAATGGGGCGAGATGGGGAGGGACGGAGTGGACGGCGTGA AND not specified

NM_001848.2(COL6A1):c.1002+50C>T AND not specified

... 1155 more


Partner site webpage screenshot on site-shot.com.