GENETIC ENCYCLOPEDIA
ABOUT US    

   

gene: LOC109611589

id109611589
symbolLOC109611589
organismHomo sapiens
full namerunt related transcription factor 2 polyalanine expansion region
summaryThis biological region is found within the coding region of the runt related transcription factor 2 (RUNX2) gene on the p arm of chromosome 6. This region contains both a polyglutamine and polyalanine stretch that are susceptible to expansions and deletions, resulting in cleidocranial dysplasia (CCD). Polyalanine expanded gene products can mislocalize from the nucleus to the cytoplasm, and form protein aggregates. Changes in the polyglutamine-coding stretch can disrupt the encoded protein. [provided by RefSeq, Jan 2017]
variant-disease

NM_001024630.4(RUNX2):c.217del (p.Ala73fs) AND Cleidocranial dysostosis

NM_001024630.4(RUNX2):c.189_203delinsACAGCAGCAGCAGCAGCAGCAACAGCAGCCG (p.Glu72fs) AND Cleidocranial dysostosis

NM_001024630.4(RUNX2):c.172_192CAACAGCAGCAGCAGCAGCAG[1] (p.Gln65_Gln71del) AND not specified

NM_001024630.4(RUNX2):c.225_242GGCGGCTGCGGCGGCGGC[1] (p.Ala84_Ala89del) AND not specified

NM_001024630.4(RUNX2):c.234G>A (p.Ala78=) AND Cleidocranial dysostosis

... 17 more


Partner site full page screenshot mobile on site-shot.com.